Submission Interface

Probe:

Back
Id: AGPAT5_Probe_1_AS_CT
Copied From:
 
PROBE IDENTIFIER
Local Probe Name: AGPAT5_CT_probe_1_AS
Strand Direction: Antisense
Note:
 
ENTITY DETECTED
Gene Id: GG:13948
Gene Symbol: AGPAT5
Gene Name: 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase epsilon) [Gallus gallus]
Ensembl Id: ENSGALG00000016329
Entrez Id: 421898
 
TEMPLATE INFORMATION
Template Clone: ChEST590g8
Template Clone Source: Roslin
 
Derived from cDNA or Genomic DNA?: cDNA
 
Fragment PCR Ampolified or Cloned?: Cloned
Enzyme Used for Linearising: NotI
Primer 1 Name: n/a
Primer 1 Sequence: n/a
Primer 2 Name: n/a
Primer 2 Sequence: n/a
 
Sequence Verified?: Yes
Partial Sequence: n/a
NCBI Accession Ids: n/a
Complete Sequence: "GCGGCTCGAGGGCGCCTGGCGCCTGCTCTCCGCCGTCCTCCCCGTCCGCTTCTACCGGGA
NCBI Id: BU291142.1
NCBI id Version: n/a
Sequence Start Coordinate: n/a
Sequence End Coordinate: n/a
 
POLYMERASE USED
Polymerase:

Back