Submission Interface

Probe:

Back
Id: MOXD1-1_Probe_2_AS_CS
Copied From:
 
PROBE IDENTIFIER
Local Probe Name: MOXD1
Strand Direction: Antisense
Note: DBHR, a Gene with Homology to Dopamine b-Hydroxylase, Is Expressed in the Neural Crest throughout Early Development. Anne K. Knecht and Marianne Bronner-Fraser. Dev Biol. 2001 Jun 15;234(2):365-75.
 
ENTITY DETECTED
Gene Id: GG:13577
Gene Symbol: MOXD1-1
Gene Name: monooxygenase DBH-like 1 [Gallus gallus]
Ensembl Id: ENSGALG00000002911
Entrez Id: 395333
 
TEMPLATE INFORMATION
Template Clone: unspecified
Template Clone Source: Marianne Bronner-Fraser
 
Derived from cDNA or Genomic DNA?:
 
Fragment PCR Ampolified or Cloned?:
Enzyme Used for Linearising: n/a
Primer 1 Name: n/a
Primer 1 Sequence: n/a
Primer 2 Name: n/a
Primer 2 Sequence: n/a
 
Sequence Verified?: Yes
Partial Sequence: n/a
NCBI Accession Ids: n/a
Complete Sequence: gcggccgctgcgcccctgggcgctgctcttgggcgcgctgctgggcgccgccgcggccgcggcgcggaggtacccgcacgtcgcggtgctggacggcgcggccgcctaccgcttgctgtggggccgccgcggcagcgcgctcgccttccgcctggaggtgcgcacccgcggctacgtgggcttcgggctctcggccggcggcggcatggcctcggccgacatcgtggtggggggcgtggagggcgggcgacccta
NCBI Id: NM_204624.1
NCBI id Version: n/a
Sequence Start Coordinate: n/a
Sequence End Coordinate: n/a
 
POLYMERASE USED
Polymerase: T3

Back