Submission Interface

Probe:

Back
Id: FSTL4-1_Probe_1_AS_CT
Copied From:
 
PROBE IDENTIFIER
Local Probe Name: FSTL4_CT_probe_1_AS
Strand Direction: Antisense
Note:
 
ENTITY DETECTED
Gene Id: GG:5261
Gene Symbol: FSTL4-1
Gene Name: follistatin-like 4 [Gallus gallus]
Ensembl Id: ENSGALG00000006514
Entrez Id: 395163
 
TEMPLATE INFORMATION
Template Clone: ChEST433o1
Template Clone Source: Roslin
 
Derived from cDNA or Genomic DNA?: cDNA
 
Fragment PCR Ampolified or Cloned?: Cloned
Enzyme Used for Linearising: Not1
Primer 1 Name: n/a
Primer 1 Sequence: n/a
Primer 2 Name: n/a
Primer 2 Sequence: n/a
 
Sequence Verified?: Yes
Partial Sequence: n/a
NCBI Accession Ids: n/a
Complete Sequence: n/a
NCBI Id: NM_204502.1
NCBI id Version: n/a
Sequence Start Coordinate: "gtaaacacgg ccgccgccgc tcccgccccg tcccgccgtc ccgcagatgt gaaatgatga
Sequence End Coordinate: "GTCTTTTTTCCCCCAGTGTAAAAATATACAATGCTACTGCTCACTTTTTGCAGCATAAAG
 
POLYMERASE USED
Polymerase: T3

Back