Submission Interface

Probe:

Back
Id: MSX2_Probe_3_AS_CS
Copied From: MSX2_Probe_1_AS_CS
 
PROBE IDENTIFIER
Local Probe Name: Msx2_CT
Strand Direction: Antisense
Note:
 
ENTITY DETECTED
Gene Id: GG:5040
Gene Symbol: MSX2
Gene Name: msh homeobox 2 [Gallus gallus]
Ensembl Id: ENSGALG00000002947
Entrez Id: 395245
 
TEMPLATE INFORMATION
Template Clone: unspecified
Template Clone Source: Cheryll Tickle lab
 
Derived from cDNA or Genomic DNA?:
 
Fragment PCR Ampolified or Cloned?: Cloned
Enzyme Used for Linearising: n/a
Primer 1 Name: n/a
Primer 1 Sequence: n/a
Primer 2 Name: n/a
Primer 2 Sequence: n/a
 
Sequence Verified?: Yes
Partial Sequence: n/a
NCBI Accession Ids: n/a
Complete Sequence: ACGCGCACAGCCCCCCCGGGGCTCTTACAAAACCTTCGACACCGCTTCGGTCAAATCGGAGAACTCGGAGGACGGCACGTCCTGGATCCAAGAGGCCGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAGCCTGCACTCTGAGGAAGCACAAGACGAATCGGAAGCCCCGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCG
NCBI Id: NM_204559.1
NCBI id Version: n/a
Sequence Start Coordinate: n/a
Sequence End Coordinate: n/a
 
POLYMERASE USED
Polymerase: T7

Back