Submission Interface

Probe:

Back
Id: PTCH2-1_Probe_2_AS_CS
Copied From:
 
PROBE IDENTIFIER
Local Probe Name: Ptch2
Strand Direction: Antisense
Note:
 
ENTITY DETECTED
Gene Id: GG:19071
Gene Symbol: PTCH2-1
Gene Name: patched homolog 2 (Drosophila) [Gallus gallus]
Ensembl Id: ENSGALG00000010133
Entrez Id: 374187
 
TEMPLATE INFORMATION
Template Clone: unspecified
Template Clone Source: unspecified
 
Derived from cDNA or Genomic DNA?:
 
Fragment PCR Ampolified or Cloned?: Cloned
Enzyme Used for Linearising: n/a
Primer 1 Name: n/a
Primer 1 Sequence: n/a
Primer 2 Name: n/a
Primer 2 Sequence: n/a
 
Sequence Verified?: Yes
Partial Sequence: n/a
NCBI Accession Ids: n/a
Complete Sequence: TCTCCAGGAAGTTCATGCGCTGGCAGGAGGAGCTGATTTTAGGCGGCACAACCAAAGACTCCCAGGGCAAGCTGCTAAGTGCTGAGGCCCTGCAGACAATGTTCCTTCTCATGAGCCCCCGGCAGCTGTATGAGCACTTCAAGGATGACTACGAGATCCATGACATCAGCTGGAGTGAGGAGAAGGCAGGTGCTATCCTGGAGGCCTGGCAGAGGAAATTTGTGGAGCTGGCACAGGACTCCATCCCACCCAATG
NCBI Id: n/a
NCBI id Version: n/a
Sequence Start Coordinate: n/a
Sequence End Coordinate: n/a
 
POLYMERASE USED
Polymerase: T7

Back