Submission Interface

Probe:

Back
Id: PTCH1_Probe_2_AS_CS
Copied From:
 
PROBE IDENTIFIER
Local Probe Name: Ptch1
Strand Direction: Antisense
Note:
 
ENTITY DETECTED
Gene Id: GG:24196
Gene Symbol: PTCH1
Gene Name: patched homolog 1 (Drosophila) [Gallus gallus]
Ensembl Id: ENSGALG00000012620
Entrez Id: 395806
 
TEMPLATE INFORMATION
Template Clone: unspecified
Template Clone Source: unspecified
 
Derived from cDNA or Genomic DNA?:
 
Fragment PCR Ampolified or Cloned?:
Enzyme Used for Linearising: n/a
Primer 1 Name: n/a
Primer 1 Sequence: n/a
Primer 2 Name: n/a
Primer 2 Sequence: n/a
 
Sequence Verified?: Yes
Partial Sequence: n/a
NCBI Accession Ids: n/a
Complete Sequence: cttgatgtagcccttgttttgagtggtggatgctatggactgtcaagaaaatacatgcattggcaggaagagttaattataggtggtacagtcaagaacagttctggtaaacttgtcagtgcccaggctttgcaaaccatgtttcagttaatgactcctaagcaaatgtatgagcacttcaagggatatgaatatgtttcacatatcaactggaatgaggataaagcagcagcaattctggaagcctggcagagg
NCBI Id: XM_015280248.1
NCBI id Version: n/a
Sequence Start Coordinate: n/a
Sequence End Coordinate: n/a
 
POLYMERASE USED
Polymerase: T3

Back