Submission Interface

Probe:

Back
Id: TLE4_Probe_1_AS_CT
Copied From:
 
PROBE IDENTIFIER
Local Probe Name: TLE4_CT_probe_1_AS
Strand Direction: Antisense
Note:
 
ENTITY DETECTED
Gene Id: GG:24148
Gene Symbol: TLE4
Gene Name: transducin-like enhancer of split 4 (E(sp1) homolog Drosophila) [Gallus gallus]
Ensembl Id: ENSGALG00000015184
Entrez Id: 374080
 
TEMPLATE INFORMATION
Template Clone: ChEST1037g2
Template Clone Source: Roslin
 
Derived from cDNA or Genomic DNA?: cDNA
 
Fragment PCR Ampolified or Cloned?: Cloned
Enzyme Used for Linearising: NotI
Primer 1 Name: n/a
Primer 1 Sequence: n/a
Primer 2 Name: n/a
Primer 2 Sequence: n/a
 
Sequence Verified?: Yes
Partial Sequence: n/a
NCBI Accession Ids: n/a
Complete Sequence: "ACAGTGATGGTGAAAAGAGTGATGACAACTTGGTAGTTGATGTTTCCAATGAGGATCCTT
NCBI Id: NM_204237
NCBI id Version: n/a
Sequence Start Coordinate: n/a
Sequence End Coordinate: n/a
 
POLYMERASE USED
Polymerase: T3

Back